Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU043271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rrm2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCACTGGGAAGCTCTGAAACCCGATGAGAGACATTTTATATCTCACGTTCTGGCTTTCTTTGCAGCGAGTGATGGCATAGTCAATGAGAACTTGGTGGAGCGATTTAGCCAAGAAGTTCAAGTTACAGAGGCCCGCTGTTTCTATGGCTTCCAAATTGCCATGGAAAACATACACTCTGAAATGTACAGTCTCCTTATTGACACTTACATTAAAGATCCCAAGGAAAGAGAATATCTCTTCAATGCTATTGAAACTATGCCTTGTGTGAAGAAGAAGGCTGACTGGGCCTTGCGCTGGATTGGGGACAAAGAGGCTACGTATGGAGAACGCGTTGTGGCCTTTGCCGCCGTAGAAGGAATCTTCTTTTCCGGTTCTTTTGCATCGATATTCTGGCTCAAGAAACGGGGGCTGATGCCGGGCCTTACATTTTCCAATGAGCTTATTAGCAGAGACGAGGGTTTACACTGTGACTTTGCCTGCCTGATGTTCAAGCACCTGGTACACAAGCCAGCGGAGCAGAGGGTCCGAGAGATAATCACCAACGCCG

N° accesso Ensembl | topo

ENSMUSG00000020649

N° accesso NCBI

NM_009104

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... RRM2(20135) , Rrm2(20135)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Zejun Fang et al.
Biochemical and biophysical research communications, 464(2), 407-415 (2015-06-21)
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2
Nagireddy Putluri et al.
Neoplasia (New York, N.Y.), 16(5), 390-402 (2014-07-14)
Breast cancer (BCa) molecular subtypes include luminal A, luminal B, normal-like, HER-2-enriched, and basal-like tumors, among which luminal B and basal-like cancers are highly aggressive. Biochemical pathways associated with patient survival or treatment response in these more aggressive subtypes are
Kazuki Iwamoto et al.
International journal of oncology, 46(5), 1971-1977 (2015-03-05)
In our previous study, ribonucleotide reductase M2 (RRM2) was identified as a cancer-related gene commonly overexpressed in human oral squamous cell carcinoma (OSCC) cell lines. Herein, we attempted to determine whether targeting RRM2 may be a plausible therapeutic approach for
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.