Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU039641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptgs2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCCTGAGTGGGGTGATGAGCAACTATTCCAAACCAGCAGACTCATACTCATAGGAGAGACTATCAAGATAGTGATCGAAGACTACGTGCAACACCTGAGCGGTTACCACTTCAAACTCAAGTTTGACCCAGAGCTCCTTTTCAACCAGCAGTTCCAGTATCAGAACCGCATTGCCTCTGAATTCAACACACTCTATCACTGGCACCCCCTGCTGCCCGACACCTTCAACATTGAAGACCAGGAGTACAGCTTTAAACAGTTTCTCTACAACAACTCCATCCTCCTGGAACATGGACTCACTCAGTTTGTTGAGTCATTCACCAGACAGATTGCTGGCCGGGTTGCTGGGGGAAGAAATGTGCCAATTGCTGTACAAGCAGTGGCAAAGGCCTCCATTGACCAGAGCAGAGAGATGAAATACCAGTCTCTCAATGAGTACCGGAAACGCTTCTCCCTGAAGCCGTACACATCATTTGAAGAACTTACAGGAGAGAAGGAAATGGCTGCAGAA

N° accesso Ensembl | topo

ENSMUSG00000032487

N° accesso NCBI

NM_011198

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... PTGS2(19225) , Ptgs2(19225)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mei Ming et al.
Cancer research, 74(20), 5925-5933 (2014-10-17)
SIRT6 is a SIR2 family member that regulates multiple molecular pathways involved in metabolism, genomic stability, and aging. It has been proposed previously that SIRT6 is a tumor suppressor in cancer. Here, we challenge this concept by presenting evidence that
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of
Qiang Bu et al.
Molecular medicine reports, 10(4), 2203-2209 (2014-08-12)
Alterations in microRNA (miRNA) expression have been shown to be involved in the tumor response to chemotherapy. However, the possible role of miR‑101 in cisplatin sensitivity in human bladder cancer cells remains unclear. In this study, quantitative polymerase chain reaction
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.