Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU028161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc2a

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Gunjan Guha et al.
PloS one, 10(5), e0125322-e0125322 (2015-05-06)
Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and
Qinghua Xi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 4939-4948 (2015-04-26)
Overexpression of cyclin-dependent kinase 1 (CDK1) has been noted to correlation with several human cancers. However, the effects of CDK1 on ovarian cancer development remain unclear. The aim of this study was to examine the effect of CDK1 and related
Qing Xia et al.
International journal of oncology, 44(3), 735-744 (2014-01-01)
Breast cancer is one of the most common malignancies in women. Approximately 15% of the patients belong to the triple-negative breast cancer (TNBC) group, and have the disadvantage of not benefiting from currently available receptor-targeted systemic therapies. Some cancers in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.