Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU021811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fn1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGTGCTTCATGCCGCTAGATGTGCAAGCTGACAGAGACGATTCTCGAGAGTAATCTTTCCAGCCCCACCCTACAAGTGTCTCTCTACCAAGGTCAATCCACACCCCAGTGATGTTAGCAGACCCTCCATCTTTGAGTGGTCCTTTCACCCTTAAGCCTTTTGCTCTGGAGCCATGTTCTCAGCTTCAGCACAATTTACAGCTTCTCCAAGCATCGCCCCGTGGGATGTTTTGAGACTTCTCTCCTCAATGGTGACAGTTGGTCACCCTGTTCTGCTTCAGGGTTTCAGTACTGCTCAGTGTTGTTTAAGAGAATCAAAAGTTCTTATGGTTTGGTCTGGGATCAATAGGGAAACACAGGTAGCCAACTAGGAGGAAATGTACTGAATGCTAGTACCCAAGACCTTGAGCAGGAAAGTCACCCAGACACCTCTGCTTTCTTTTGCC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenjian Wang et al.
Kidney international, 81(10), 1002-1014 (2012-03-02)
Scavenger receptor A (SR-A) is a key transmembrane receptor in the endocytosis of lipids and contributes to the pathogenesis of atherosclerosis. To assess its role in hyperlipidemic chronic kidney disease, wild-type and SR-A-deficient (knockout) mice underwent uninephrectomy followed by either
H W Zhang et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 26-32 (2015-05-31)
Endothelial progenitor cells (EPCs) could function as niche cells to promote self—renewal of mesenchymal stem cells (MSCs) in the mouse bone marrow. Cohesion was the basis of the two cells to display their biological functions to each other. In this
Tong-Peng Xu et al.
Journal of hematology & oncology, 7, 63-63 (2014-08-30)
FENDRR is a long non-coding RNAs (lncRNA) that binds to polycomb repressive complexe 2 (PRC2) to epigenetically regulate the expression of its target gene. The clinical role of FENDRR in carcinomas remains yet to be found. Real-time polymerase chain reaction

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.