Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU021051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnfrsf10b

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCAGTGCGTTTGAAGTCAGCCTGATCTACTTAGTGAACTCAGGACAGCCAAGGCTATGTAGAGAGCCCCGAAGATGCAGGCTCTTCAGTATTATGAGAATGTACTTAATTTTTTCTTGTAGTAGTTAGTGTATCATATTATTGTATTATTTATATTATTACTGTTAAGTACTATGTTCTCTTATTAGAAGTTGAACACAGAACCTCTGAGAACACATATGCTACAAGTGTTCTAACACACCTCCAGCATCCCGGATTACCTTTGTTCCTGAACAAGGCACAATTGGTAGGGTATGATAGGGCCTGCCTATCATCCTAACACTCCGGTGATGGAGCCAGGAAGATCAAGAGTTCGAGGCCAGCTGGTTCACATAAGATCCCATATAATGTGCAGGATGGCTAAACTTGCTGAGAGCTGACTCTGTGGTCTCCTGTCCCAGATTC

N° accesso Ensembl | topo

ENSMUSG00000022074

N° accesso NCBI

NM_020275

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... TNFRSF10B(21933) , Tnfrsf10b(21933)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Ci dispiace, ma al momento non ci sono COA disponibili online per questo prodotto.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hemn Mohammadpour et al.
Photodiagnosis and photodynamic therapy, 12(2), 238-243 (2015-02-28)
Mesenchymal stem cells are multi-potent progenitor cells that inhibit tumor growth by some ligands and releasing factors including TRAIL, DKK-1 and DKK-3. On other hands, photodynamic therapy is commonly used for treatment of different types of cancer. The aims of
Deokil Shin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1151-1162 (2015-06-27)
Although Vitisin A, derived from wine grapes, is known to have cytotoxic, anti-adipogenic, anti-inflammatory and antioxidant effects, the underlying antitumor mechanism has not been investigated in prostate cancer cells to date. In the present study, the apoptotic mechanism of Vitisin
Huilian Huang et al.
Clinical laboratory, 61(10), 1501-1508 (2015-12-09)
Mounting evidence indicates that nuclear targeting by growth factors plays an indispensable role on their biological activities. Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize
Jiahe Li et al.
Scientific reports, 5, 9987-9987 (2015-05-20)
Malignant transformation results in increased levels of reactive oxygen species (ROS). Adaption to this toxic stress allows cancer cells to proliferate. Recently, piperlongumine (PL), a natural alkaloid, was identified to exhibit novel anticancer effects by targeting ROS signaling. PL induces
Seon Min Woo et al.
Oncotarget, 6(13), 11614-11626 (2015-04-07)
FTY720, Fingolimod, is a functional antagonist to the sphingosine-1-phosphate (S1P) receptor and an inhibitor of sphingosine kinase 1. Here, we showed that a combination of FTY720 and TRAIL induced apoptosis in human renal, breast, and colon carcinoma cells. Most importantly

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.