Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU017111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pgp

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGACCCACACTTCAGCTACATGAAGCTCACCAAGGCCGTGCGGTACCTGCAGCAGCCCGACTGTCTGCTCGTGGGCACCAACATGGACAACCGGCTCCCGCTAGAGAACGGCCGTTTCATTGCGGGTACCGGCTGTCTGGTGCGAGCCGTGGAGATGGCCGCCCAGCGCCAGGCGGACATCATCGGGAAGCCTAGCCGCTTCATCTTCGACTGCGTGTCCCAGGAGTATGGTATCAACCCGGAGCGCACCGTCATGGTGGGAGACCGCCTGGACACAGACATCCTCCTGGGCTCCACCTGTAGCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTGAGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCCGACCTCTT

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hui-Hui Guo et al.
Nature communications, 10(1), 1981-1981 (2019-05-02)
Cardiovascular and metabolic disease (CMD) remains a main cause of premature death worldwide. Berberine (BBR), a lipid-lowering botanic compound with diversified potency against metabolic disorders, is a promising candidate for ameliorating CMD. The liver is the target of BBR so
Hong Yang et al.
Biomaterials science, 6(9), 2426-2439 (2018-07-25)
The efficacy of cancer chemotherapy can be generally restrained by the multiple drug resistance (MDR) of tumors, which is typically attributed to the upregulation of ATP-binding cassette (ABC) transporter proteins, such as P-glycoprotein (P-gp). There is an urgent need to
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR
Anting Jin et al.
Bioactive materials, 5(3), 522-541 (2020-04-24)
Inspired by the mechanism of mussel adhesion, polydopamine (PDA), a versatile polymer for surface modification has been discovered. Owing to its unique properties like extraordinary adhesiveness, excellent biocompatibility, mild synthesis requirements, as well as distinctive drug loading approach, strong photothermal
Nadejda Sigal et al.
Infection and immunity, 83(6), 2358-2368 (2015-04-01)
Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.