Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU015631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lamp1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACATCAGCCCAAATGACACATCTAGTGGGAGTTGCGGTATCAACTTGGTGACCCTGAAAGTGGAGAACAAGAACAGAGCCCTGGAATTGCAGTTTGGGATGAATGCCAGCTCTAGCCTGTTTTTCTTGCAAGGAGTGCGCTTGAATATGACTCTTCCTGATGCCCTAGTGCCCACATTCAGCATCTCCAACCATTCACTGAAAGCTCTTCAGGCCACTGTGGGAAACTCATACAAGTGCAACACTGAGGAACACATCTTTGTCAGCAAGATGCTCTCCCTCAATGTCTTCAGTGTGCAGGTCCAGGCTTTCAAGGTGGACAGTGACAGGTTTGGGTCTGTGGAAGAGTGTGTTCAGGATGGTAACAACATGTTGATCCCCATTGCTGTGGGCGGTGCCCTGGCAGGGCTGATCCTCATCGTCCTCATTGC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Akhil Kumar Agarwal et al.
Biochemical and biophysical research communications, 449(3), 332-337 (2014-05-23)
Lysosome Associated Membrane Protein-1 (LAMP1), which lines the lysosomes, is often found to be expressed on surface of metastatic cells. We previously demonstrated that its surface expression on B16 melanoma variants correlates with metastatic potential. To establish the role of
Xiang Y Kong et al.
Disease models & mechanisms, 7(3), 351-362 (2014-02-04)
Human kidney predominant protein, NCU-G1, is a highly conserved protein with an unknown biological function. Initially described as a nuclear protein, it was later shown to be a bona fide lysosomal integral membrane protein. To gain insight into the physiological
Takahito Miyake et al.
Glia, 63(10), 1870-1882 (2015-05-27)
Microglia, the resident immune cells in the brain, survey the environment of the healthy brain. Microglial migration is essential for many physiological and pathophysiological processes. Although microglia express some members of the transient receptor potential (TRP) channel family, there is

Global Trade Item Number

SKUGTIN
EMU015631-20UG4061828462698
EMU015631-50UG4061828227334

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.