Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU014751

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Eif2ak3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGATCAAATGGAAGCCCTTAATCCATTCTCCTTCTAGGACTCCTGTCTTGGTTGGGTCTGATGAATTTGACAAATGTCTAAGTAATGATAAGTATTCCCACGAAGAATACAGTAATGGTGCACTTTCAATCCTCCAGTATCCATACGATAACGGTTACTATCTGCCATACTACAAGAGAGAAAGGAATAAGCGGAGCACGCAGATCACAGTCAGGTTCCTGGACAGCCCCCACTACAGCAAGAACATCCGCAAGAAGGACCCTATCCTCCTGCTGCACTGGTGGAAGGAGATATTCGGGACGATCCTGCTTTGCATCGTAGCCACGACCTTCATCGTGCGCAGGCTTTTCCATCCTCAGCCCCACAGGCAGCGGAAGGAGTCTGAAACTCAGTGCCAGACTGAAAGTAAATACGACTCCGTGAGTGCC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yue Wang et al.
Antiviral research, 106, 33-41 (2014-04-01)
The unfolded protein response (UPR) is cyto-protective machinery elicited towards an influx of large amount of protein synthesis in the endoplasmic reticulum (ER). Extensive studies suggest that the UPR can also be activated during virus infection. In the present studies
Genkai Guo et al.
Journal of immunology research, 2015, 183738-183738 (2015-06-20)
Previous studies indicated that bone marrow mesenchymal stem cells (BM-MSCs) from patients with systemic lupus erythematosus (SLE) exhibited the phenomenon of apoptosis. In this study, we aimed to investigate whether apoptosis of BM-MSCs from SLE patients were dysregulated. In this
Fei Sun et al.
Toxicology, 325, 52-66 (2014-08-19)
While it has been well-documented that excessive fluoride exposure caused the skeletal disease and osteoblasts played a critical role in the advanced skeletal fluorosis, the underlying mechanism that mediated these effects remain poorly understood. The present study was undertaken to
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.