Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU011371

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGGCCAACTCGTTTGTAGGGACGCGCTCCTACATGTCCCCAGAGCGGCTGCAGGGCACCCACTACTCTGTGCAGTCGGACATCTGGAGCATGGGGCTGTCGCTGGTGGAGCTGGCCATCGGGAGGTATCCCATTCCCCCACCTGATGCCAAGGAACTAGAGGCCAGCTTTGGCCGGCCTGTGGTGGACGGGGCAGACGGAGAACCCCATAGTGTCTCCCCGAGGCCCAGGCCCCCTGGACGCCCCATCAGTGTAGGTCATGGGATGGACAGCCGACCGGCCATGGCCATCTTTGAGCTGCTGGACTACATAGTGAACGAGCCACCTCCCAAGCTGCCCAGTGGTGTGTTCAGCTCAGACTTCCAGGAGTTTGTGAATAAATGTCTCATTAAGAACCCAGCAGAGCGAGCAGATCTGAAGC

N° accesso Ensembl | topo

ENSMUSG00000035027

N° accesso NCBI

NM_023138

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... MAP2K2(26396) , Map2k2(26396)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Simona Gargiulo et al.
International journal of molecular sciences, 13(11), 14278-14293 (2012-12-04)
The hypercholesterolemia-atherosclerosis association is now established; hypercholesterolemia may induce vascular-cell activation, subsequently increasing expression of adhesion molecules, cytokines, chemokines, growth factors, and other key inflammatory molecules. Among inflammatory molecules expressed by vascular cells, integrins play a critical role in regulating
Sara Alves et al.
Oncotarget, 6(31), 30787-30802 (2015-09-30)
The recent interest to modulate autophagy in cancer therapy has been hampered by the dual roles of this conserved catabolic process in cancer, highlighting the need for tailored approaches. Since RAS isoforms have been implicated in autophagy regulation and mutation
Caroline N Mills et al.
Molecular cancer, 8, 104-104 (2009-11-19)
Hypoxia inducible factor-1 alpha (HIF-1alpha) protein is rapidly degraded under normoxic conditions. When oxygen tensions fall HIF-1alpha protein stabilizes and transactivates genes involved in adaptation to hypoxic conditions. We have examined the normoxic expression of HIF-1alpha RNA and protein in
Lei-Lei Chen et al.
Autophagy, 13(11), 1969-1980 (2017-09-22)
Recent studies have demonstrated that dysregulation of macroautophagy/autophagy may play a central role in the pathogenesis of neurodegenerative disorders, and the induction of autophagy protects against the toxic insults of aggregate-prone proteins by enhancing their clearance. Thus, autophagy has become
Kazutaka Nanba et al.
Endocrinology, 156(5), 1750-1756 (2015-02-14)
There is considerable evidence supporting the role of calcium signaling in adrenal regulation of both aldosterone synthase (CYP11B2) and aldosterone production. However, there have been no studies that investigated the role played by the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK) in
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.