Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU010551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Spp1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCTGATGAGACCGTCACTGCTAGTACACAAGCAGACACTTTCACTCCAATCGTCCCTACAGTCGATGTCCCCAACGGCCGAGGTGATAGCTTGGCTTATGGACTGAGGTCAAAGTCTAGGAGTTTCCAGGTTTCTGATGAACAGTATCCTGATGCCACAGATGAGGACCTCACCTCTCACATGAAGAGCGGTGAGTCTAAGGAGTCCCTCGATGTCATCCCTGTTGCCCAGCTTCTGAGCATGCCCTCTGATCAGGACAACAACGGAAAGGGCAGCCATGAGTCAAGTCAGCTGGATGAACCAAGTCTGGAAACACACAGACTTGAGCATTCCAAAGAGAGCCAGGAGAGTGCCGATCAGTCGGATGTGATCGATAGTCAAGCAAGTTCCAAAGCCAGCCTGGAACATCAGAGCCACAA

N° accesso Ensembl | topo

ENSMUSG00000029304

N° accesso NCBI

NP_033289

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... SPP1(20750) , Spp1(20750)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
Karl Blirando et al.
Digestive diseases and sciences, 60(6), 1633-1644 (2015-01-13)
Radiation damage to the normal gut is a dose-limiting factor in the application of radiation therapy to treat abdominal and pelvic cancers. All tissue cell types react in concert to orchestrate an acute inflammatory reaction followed by a delayed chronic
Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.