Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU232231

Sigma-Aldrich

MISSION® esiRNA

targeting human IRGM

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGAAGCCATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCTTCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACCCTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCTGCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAGTTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTGCAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAA

N° accesso Ensembl | uomo

ENSG00000237693

N° accesso NCBI

NM_001145805

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IRGM(345611) , IRGM(345611)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yu-Cheng Lin et al.
Journal of hepatology, 65(6), 1209-1216 (2016-07-16)
Autophagy has been shown to be crucial in the regulation of the intracellular lipid stores in hepatocytes. We hypothesize that immunity-related GTPase family M (IRGM) gene (an autophagy-related gene) variants confer the susceptibility to non-alcoholic fatty liver disease (NAFLD) development.
Chih-Peng Chang et al.
PloS one, 6(12), e28323-e28323 (2011-12-14)
Interferon-gamma (IFN-γ), a potent Th1 cytokine with multiple biological functions, can induce autophagy to enhance the clearance of the invading microorganism or cause cell death. We have reported that Concanavalin A (Con A) can cause autophagic cell death in hepatocytes
Xize Guo et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14768-14779 (2020-09-18)
Mitochondria is a double membrane-bound cellular organelle that generates energy to maintain the homeostasis of cells. Immunity-related GTPase M (IRGM) in human locates at the inner membrane of mitochondria and is best known for its role in regulating autophagy against
Kautilya Kumar Jena et al.
EMBO reports, 21(9), e50051-e50051 (2020-07-28)
Activation of the type 1 interferon response is extensively connected to the pathogenesis of autoimmune diseases. Loss of function of Immunity Related GTPase M (IRGM) has also been associated to several autoimmune diseases, but its mechanism of action is unknown.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.