Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU157961

Sigma-Aldrich

MISSION® esiRNA

targeting human CD74

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACACAGGCTTTTCCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGCCACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAGACTGGAAGGTCTTTGAGAGCTGGATGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Pei-Chi Chan et al.
Clinical science (London, England : 1979), 132(14), 1581-1596 (2018-05-19)
Adipose tissue (AT) inflammation is crucial to the development of obesity-associated insulin resistance. Our aim was to investigate the contribution of cyclooxygenase-2 (COX-2)/macrophage migration inhibitory factor (MIF)-mediated cross-talk between hypertrophic adipocytes and macrophages to the etiology of AT inflammation and
Jun-Wei Gai et al.
Oncology letters, 15(5), 7631-7638 (2018-05-08)
The aim of the present study was to investigate the expression and potential roles of CD74 in human urothelial cell carcinoma of the bladder (UCB) in vitro and in vivo. CD74 and macrophage migration inhibitory factor (MIF) were located and
Jing-Nan Liang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2441-2450 (2019-06-09)
Although macrophage migration inhibitory factor (MIF) is known to have antioxidant property, the role of MIF in cardiac fibrosis has not been well understood. We found that MIF was markedly increased in angiotension II (Ang-II)-infused mouse myocardium. Myocardial function was
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.