Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU153671

Sigma-Aldrich

MISSION® esiRNA

targeting human PTX3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATTCAGAGGAAGGGCTCACATCCTTGTGGGTAAATGGTGAACTGGCGGCTACCACTGTTGAGATGGCCACAGGTCACATTGTTCCTGAGGGAGGAATCCTGCAGATTGGCCAAGAAAAGAATGGCTGCTGTGTGGGTGGTGGCTTTGATGAAACATTAGCCTTCTCTGGGAGACTCACAGGCTTCAATATCTGGGATAGTGTTCTTAGCAATGAAGAGATAAGAGAGACCGGAGGAGCAGAGTCTTGTCACATCCGGGGGAATATTGTTGGGTGGGGAGTCACAGAGATCCAGCCACATGGAGGAGCTCAGTATGTTTCATAAATGTTGTGAAACTCCACTTGAAGCCAAAGAAAGAAACTCACACTTAAAACACATGCCAGTTGGGAAGGTCTGAAAACTCAGTGCATAATAGGAACACTTGAGACTAATGAAAGAGAGAGTTGAGACCAATCTTTATTTGTACTGGCCAAATACTGAATAAACAGTTGAAGGAAAGACATTGGAAAAAGCTTTTGAGGATAATGTTACTAGACTTTATGCCATGGTGCTTTCA

N° accesso Ensembl | uomo

ENSG00000163661

N° accesso NCBI

NM_002852

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PTX3(5806) , PTX3(5806)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Christina L O'Neill et al.
Cardiovascular research, 112(3), 677-688 (2016-09-24)
Circulating angiogenic cells (CACs) promote revascularization of ischaemic tissues although their underlying mechanism of action and the consequences of delivering varying number of these cells for therapy remain unknown. This study investigates molecular mechanisms underpinning CAC modulation of blood vessel
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Xian-Yuan Luo et al.
Cell biology international (2018-05-10)
MicroRNAs (miRNAs) have been known to function as important regulators in the vascular system, with various physiopathological effects such as vascular remodeling and hypertension modulation. We aimed to explore whether microRNA-150 (miR-150) regulates endothelial cell function and vascular remodeling in
Yeon Kim et al.
International journal of molecular sciences, 20(22) (2019-11-21)
Pentraxin-3 (PTX3) is recognized as a modulator of inflammation and a mediator of tissue repair. In this study, we characterized the role of PTX3 on some biological functions of human dental pulp stem cells (HDPSCs). The expression level of PTX3
Narae Hwang et al.
International journal of molecular sciences, 20(23) (2019-12-05)
: (1) Background: Age-related macular degeneration (AMD) is closely related with retinal pigment epithelial (RPE) cell dysfunction. Although the exact pathogenesis of AMD remains largely unknown, oxidative stress-induced RPE damage is believed to be one of the primary causes. We
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.