Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU146271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNF1A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TACCTGCAGCAGCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAACCAGTCCCACCTGTCCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAGCGGGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGCAGTTCACCCATGCAGGGCAGGGAGGGCTGATTGAAGAGCCCACAGGTGATGAGCTACCAACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAGCATCCCAGCAGATCCTGTTCCAGGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAGAGACGCTAGTGGAGGAGTGCAATAGGGCGGAATGCATCCAGAGAGGGGTGTCCCCATCACAGGCACAGGGGCTGGGCTCCAACCTCGTCACGGAGGTGCGTGTCTACAACTGGTTTGCCAACC

N° accesso Ensembl | uomo

ENSG00000135100

N° accesso NCBI

NM_000545

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HNF1A(6927) , HNF1A(6927)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ethan V Abel et al.
eLife, 7 (2018-08-04)
The biological properties of pancreatic cancer stem cells (PCSCs) remain incompletely defined and the central regulators are unknown. By bioinformatic analysis of a human PCSC-enriched gene signature, we identified the transcription factor HNF1A as a putative central regulator of PCSC
Oğuzhan Fatih Baltacı et al.
Turkish journal of medical sciences, 48(3), 620-627 (2018-06-20)
Background/aim: MODY3 associated with HNF1A is the most common form of MODY and is clinically misdiagnosed as type 1 diabetes due to similar clinical symptoms. This study aimed to analyze the role of HNF1A-regulated miRNAs as a biomarker in the
Shipra Shukla et al.
Cancer cell, 32(6), 792-806 (2017-11-21)
Prostate cancer exhibits a lineage-specific dependence on androgen signaling. Castration resistance involves reactivation of androgen signaling or activation of alternative lineage programs to bypass androgen requirement. We describe an aberrant gastrointestinal-lineage transcriptome expressed in ∼5% of primary prostate cancer that
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Weigong Zhao et al.
International journal of molecular sciences, 16(5), 11699-11712 (2015-05-27)
MicroRNAs (miRNAs) have been reported to have diverse biological roles in regulating many biological processes, including osteogenic differentiation. In the present study, we identified that miR-24 was a critical regulator during osteogenic differentiation. We found that overexpression of miR-24 significantly

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.