Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU144891

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGG

N° accesso Ensembl | uomo

ENSG00000125266

N° accesso NCBI

NM_004093

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... EFNB2(1948) , EFNB2(1948)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Maha Coucha et al.
PloS one, 14(1), e0210523-e0210523 (2019-01-09)
We have previously shown that diabetes causes dysfunctional cerebral neovascularization that increases the risk for cerebrovascular disorders such as stroke and cognitive impairment. Pericytes (PCs) play a pivotal role in the angiogenic process through their interaction with the endothelial cells
Feng Zhu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109972-109972 (2020-02-10)
Ephrin-2 (EFNB2) is expressed at abnormally high levels in some neoplasms, such as squamous cell carcinoma of the head and neck and colorectal cancer. Its overexpression is associated with the malignant progression of tumors. However, the expression of EFNB2 in
Shilpa Bhatia et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4539-4550 (2018-06-01)
Purpose: The clinical success of targeted therapies such as cetuximab and radiotherapy (RT) is hampered by the low response rates and development of therapeutic resistance. In the current study, we investigated the involvement of EphB4-ephrin-B2 protumorigenic signaling in mediating resistance
Eri Sasabe et al.
PloS one, 12(11), e0188965-e0188965 (2017-12-01)
Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck and frequently metastasizes to cervical lymph nodes. Aggressive local invasion and metastasis of OSCC are significant factors for poor prognosis. In this study, we investigated
Yan Hu et al.
Neuroscience bulletin, 30(3), 425-432 (2014-01-31)
Postmitotic neurons in the neocortex migrate to appropriate positions and form layered structures of nascent cortex during brain development. The migration of these neurons requires precise control and coordination of a large number of molecules such as axon guidance cues.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.