Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU143271

Sigma-Aldrich

MISSION® esiRNA

targeting human ILK

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

N° accesso Ensembl | uomo

ENSG00000166333

N° accesso NCBI

NM_001014794

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ILK(3611) , ILK(3611)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Patricia Sosa et al.
Aging and disease, 9(5), 769-784 (2018-10-03)
In mammalians, advancing age is associated with sarcopenia, the progressive and involuntary loss of muscle mass and strength. Hyperphosphatemia is an aging-related condition involved in several pathologies. The aim of this work was to assess whether hyperphosphatemia plays a role
Xiu-Mei Yang et al.
Investigative ophthalmology & visual science, 59(5), 1779-1789 (2018-04-04)
Vasculogenesis has been shown to contribute to the formation of choroidal neovascularization (CNV). However, the mechanism behind the recruitment of endothelial progenitor cells (EPC) to CNV is not well understood. Therefore, we were interested to know whether integrin-linked kinase (ILK)
Maria Louca et al.
Molecular and cellular biochemistry, 471(1-2), 143-153 (2020-06-09)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor and it is associated with poor survival. Integrin-linked kinase (ILK) is a serine/threonine protein pseudo-kinase that binds to the cytoplasmic domains of β1 and β3 integrins and has been
Zhen-Hua Liu et al.
Nutrition and cancer, 72(6), 968-975 (2019-10-02)
The change of fatty acid composition has been regarded as an indicator of altered lipid metabolism during human tumourigenesis, but the details are still unclear. We have previously demonstrated a monounsaturated fatty acid (MUFA) named oleic acid (OA) was involved
A Shvab et al.
Oncogene, 35(5), 549-557 (2015-04-29)
Overactivation of Wnt-β-catenin signaling, including β-catenin-TCF target gene expression, is a hallmark of colorectal cancer (CRC) development. We identified the immunoglobulin family of cell-adhesion receptors member L1 as a β-catenin-TCF target gene preferentially expressed at the invasive edge of human
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.