Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU134591

Sigma-Aldrich

MISSION® esiRNA

targeting human PDE4B

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCAGGAAAGAGACCTCCTAAAGACATTCAGAATCTCATCTGACACATTTATAACCTACATGATGACTTTAGAAGACCATTACCATTCTGACGTGGCATATCACAACAGCCTGCACGCTGCTGATGTAGCCCAGTCGACCCATGTTCTCCTTTCTACACCAGCATTAGACGCTGTCTTCACAGATTTGGAGATCCTGGCTGCCATTTTTGCAGCTGCCATCCATGACGTTGATCATCCTGGAGTCTCCAATCAGTTTCTCATCAACACAAATTCAGAACTTGCTTTGATGTATAATGATGAATCTGTGTTGGAAAATCATCACCTTGCTGTGGGTTTCAAACTGCTGCAAGAAGAACACTGTGACATCTTCATGAATCTCACCAAGAAGCAGCGTCAGACAC

N° accesso Ensembl | uomo

ENSG00000184588

N° accesso NCBI

NM_001037339

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PDE4B(5142) , PDE4B(5142)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
XZS
QLS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xue-Qi Liu et al.
Biochemical pharmacology, 180, 114132-114132 (2020-07-06)
Acute kidney injury (AKI), characterized by a rapid decline in renal function, is triggered by an acute inflammatory response that leads to kidney damage. An effective treatment for AKI is lacking. Using in vitro and in vivo AKI models, our
Dan Li et al.
International immunopharmacology, 90, 107176-107176 (2020-11-28)
Roflupram (ROF) is a novel phosphodiesterase 4 inhibitor. We previously found that ROF suppressed the production of pro-inflammatory factors in microglial cells; however, the underlying mechanisms are largely unknown. The present study aimed to elucidate the underlying molecular mechanisms of
Jiahong Zhong et al.
Free radical biology & medicine, 135, 87-101 (2019-03-01)
The etiology of Parkinson's disease (PD) is generally not well understood, but it is believed to involve excessive oxidative insult. Hence, identifying therapeutic targets and compounds that exhibit protective effects against oxidative damage is a reasonable strategy to slow down
Hongyan Ma et al.
Biochemical and biophysical research communications, 450(4), 1560-1567 (2014-07-16)
Acute lung injury (ALI), acute respiratory distress syndrome (ARDS), is actually involved in an ongoing and uncontrolled inflammatory response in lung tissues. Although extensive studies suggested that phospodiesterase type 4B (PDE4B) may be related to inflammation, the underlying cell biological

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.