Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU133161

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1H4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ting Fu et al.
Molecular endocrinology (Baltimore, Md.), 30(1), 92-103 (2015-10-28)
The bile acid (BA)-sensing nuclear receptor, farnesoid X receptor (FXR), regulates postprandial metabolic responses, including inhibition of BA synthesis, by inducing the intestinal hormone, fibroblast growth factor (FGF)15 (FGF19 in human). In this study, we tested a novel hypothesis that
Wenxuan Xu et al.
IUBMB life, 68(5), 376-387 (2016-03-31)
Hepatic stellate cells (HSCs) are universally acknowledged to play a stimulative role in the pathogenesis of hepatic fibrosis and portal hypertension. HSCs when activated in response to liver injury are characterized with many changes, with HSC contraction being the most
Hai Hu et al.
Oncotarget, 8(20), 33265-33275 (2017-04-13)
Bile acids (BAs) was critical in the initiation and progression of various tumors. However, their prognostic significance in pancreatic cancer was still illusive. In the present study, the expression and biological significance of FXR, a major receptor of BAs, in
Wenxuan Xu et al.
Toxicology and applied pharmacology, 315, 23-34 (2016-12-13)
Alcoholic liver disease (ALD) is a common etiology of liver diseases, characterized by hepatic steatosis. We previously identified farnesoid X receptor (FXR) as a potential therapeutic target for ALD. Dihydroartemisinin (DHA) has been recently identified to possess potent pharmacological activities
Renchao Dong et al.
European journal of pharmacology, 857, 172461-172461 (2019-06-21)
Estrogen-induced cholestasis is a common etiology of hepatic diseases in women with contraceptives administration, pregnancy or hormone replacement therapy. Farnesoid X receptor (FXR) is a member of nuclear receptor super family of ligand-activated transcription factors that is highly expressed in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.