Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Dan Cao et al.
Liver international : official journal of the International Association for the Study of the Liver, 37(1), 80-89 (2016-06-07)
Although it is well established that fatty acids (FA) are indispensable for the proliferation and survival of cancer cells in hepatocellular carcinoma (HCC), inhibition of Fatty Acid Synthase (FASN) cannot completely repress HCC cell growth in culture. Thus, we hypothesized
Débora C Bastos et al.
The Journal of pathology, 253(3), 292-303 (2020-11-10)
Loss of the tumor suppressor gene Pten in murine prostate recapitulates human carcinogenesis and causes stromal proliferation surrounding murine prostate intraepithelial neoplasia (mPIN), which is reactive to microinvasion. In turn, invasion has been shown to be regulated in part by
Arif Khan et al.
International journal of nanomedicine, 15, 5575-5589 (2020-08-18)
The overexpression of Her-2 in 25-30% breast cancer cases and the crosstalk between Her-2 and fatty acid synthase (FASN) establishes Her-2 as a promising target for site-directed delivery. The present study aimed to develop the novel lipid base formulations to
Valeryia Mikalayeva et al.
International journal of molecular sciences, 20(6) (2019-03-21)
Both cytosolic fatty acid synthesis (FAS) and mitochondrial fatty acid oxidation (FAO) have been shown to play a role in the survival and proliferation of cancer cells. This study aimed to confirm experimentally whether FAS and FAO coexist in breast

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.