Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU130241

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAAATGGTGTCTGCAAGTGGCCCGGATGTGAGAAGGTCTTCGAAGAGCCAGAGGACTTCCTCAAGCACTGCCAGGCGGACCATCTTCTGGATGAGAAGGGCAGGGCACAATGTCTCCTCCAGAGAGAGATGGTACAGTCTCTGGAGCAGCAGCTGGTGCTGGAGAAGGAGAAGCTGAGTGCCATGCAGGCCCACCTGGCTGGGAAAATGGCACTGACCAAGGCTTCATCTGTGGCATCATCCGACAAGGGCTCCTGCTGCATCGTAGCTGCTGGCAGCCAAGGCCCTGTCGTCCCAGCCTGGTCTGGCCCCCGGGAGGCCCCTGACAGCCTGTTTGCTGTCCGGAGGCACCTGTGGGGTAGCCATGGAAACAGCACATTCCCAGAGTTCCTCCACAACATGGACTACTTCAAGTTCCACAACATGCGACCCCCTTTCACCTACGCCACGCTCATCCGCTGGGCCATCCTGGAGGCTCCAGAGAAGCAGCGGACACTCAAT

N° accesso Ensembl | uomo

ENSG00000049768

N° accesso NCBI

NM_001114377

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FOXP3(50943) , FOXP3(50943)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hanwei Zhang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5349-5361 (2016-11-03)
The transcriptional regulation mediating cancer cell differentiation into distinct molecular subtypes and modulating sensitivity to existing treatments is an enticing therapeutic target. Our objective was to characterize the ability of the forkhead/winged transcription factor FOXP3 to modulate the differentiation of
Grethe Skretting et al.
Journal of cellular biochemistry, 120(8), 12924-12936 (2019-03-13)
Single nucleotide polymorphisms (SNPs) may play an important role in the risk of certain diseases. We have previously shown that the -287T/C SNP of the tissue factor pathway inhibitor (TFPI) gene promoter region exerts differential impact on TFPI mRNA expression;
Dong Fan et al.
Oncology letters, 20(6), 292-292 (2020-10-27)
Forkhead box P3 (FOXP3), an X-linked tumor suppressor gene, plays an important role in breast cancer. However, the biological functions of FOXP3 in breast cancer apoptosis remain unclear. To investigate the underlying genes and networks regulated by FOXP3 in breast
Chun Li et al.
Pathology, research and practice, 213(10), 1251-1256 (2017-09-25)
Our study aimed to investigate the biological role of FOXP3 expression in human lung adenocarcinoma (LAD) tissues and evaluate its involvement in cell proliferation and chemosensitivity to cisplatin in LAD cells. Paraffin-embedded tissues from 50 LAD patients were collected to
Maria Napolitano et al.
Oncotarget, 6(10), 8261-8270 (2015-04-01)
Short-course preoperative radiotherapy (SC-RT) followed by total mesorectal excision (TME) is one therapeutic option for locally advanced rectal cancer (LARC) patients. Since radio-induced DNA damage may affect tumor immunogenicity, Myeloid-derived suppressor cells (MDSCs) and T regulatory cells (Tregs) were evaluated
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.