Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU129801

Sigma-Aldrich

MISSION® esiRNA

targeting human PRSS12

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTCACAGCAGCACACTGTTTCAAGAGGTATGGCAACAGCACTAGGAGCTATGCTGTTAGGGTTGGAGATTATCATACTCTGGTACCAGAGGAGTTTGAGGAAGAAATTGGAGTTCAACAGATTGTGATTCATCGGGAGTATCGACCCGACCGCAGTGATTATGACATAGCCCTGGTTAGATTACAAGGACCAGAAGAGCAATGTGCCAGATTCAGCAGCCATGTTTTGCCAGCCTGTTTACCACTCTGGAGAGAGAGGCCACAGAAAACAGCATCCAACTGTTACATAACAGGATGGGGTGACACAGGACGAGCCTATTCAAGAACACTACAACAAGCAGCCATTCCCTTACTTCCTAAAAGGTTTTGTGAAGAACGTTATAAGGGTCGGTTTACAGGGAGAATGCTTTGTGCTGGAAACCTCCATGAACACAAACGCGTGGACAGCTGCCAGGGAGACAGCGGAGGACCACTCATGTGTGAACGGCCCGGAGAGAGCTGGGTGGTGTATGGGGTGACCTC

N° accesso Ensembl | uomo

ENSG00000164099

N° accesso NCBI

NM_003619

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PRSS12(8492) , PRSS12(8492)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ah-Rong Nam et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(3), 886-900 (2018-10-05)
Jab1 is a coactivator of c-Jun that enhances the transcriptional function of c-Jun. Jab1 is frequently overexpressed in various cancers and is associatedwith poor prognosis of cancer patients. Thus, Jab1 could be a potential therapeutic target in cancer. However, the
Judit Iván et al.
Stem cells and development, 26(23), 1724-1733 (2017-10-11)
Free fatty acid receptor 2 (FFAR2, also known as GPR43) is a G-protein-coupled receptor activated by short-chain fatty acids that are produced by gut microbiota through fermentation of nondigestible carbohydrates. FFAR2 functions as a metabolic sensor and is expressed in
J J Souchek et al.
British journal of cancer, 111(6), 1139-1149 (2014-07-16)
Despite its promise as a highly useful therapy for pancreatic cancer (PC), the addition of external beam radiation therapy to PC treatment has shown varying success in clinical trials. Understanding PC radioresistance and discovery of methods to sensitise PC to
Yang Zhang et al.
American journal of physiology. Lung cellular and molecular physiology, 307(2), L173-L185 (2014-05-20)
The inflammatory response is a primary mechanism in the pathogenesis of ventilator-induced lung injury. Autophagy is an essential, homeostatic process by which cells break down their own components. We explored the role of autophagy in the mechanisms of mechanical ventilation-induced
Shun-Yao Ko et al.
PloS one, 9(10), e110542-e110542 (2014-10-21)
Advanced glycation end products (AGEs) are produced in an irreversible non-enzymatic reaction of carbohydrates and proteins. Patients with diabetes mellitus (DM) are known to have elevated AGE levels, which is viewed as a risk factor of diabetes-related complications. In a
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.