Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU113621

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2C

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACAAACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGCTCACT

N° accesso Ensembl | uomo

ENSG00000081189

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MEF2C(4208) , MEF2C(4208)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mingliang Bai et al.
EMBO reports, 21(11), e50283-e50283 (2020-10-06)
A microdeletion within human chromosome 5q14.3 has been associated with the occurrence of neurodevelopmental disorders, such as autism and intellectual disability, and MEF2C haploinsufficiency was identified as main cause. Here, we report that a brain-enriched long non-coding RNA, NDIME, is located
Aleksandra Deczkowska et al.
Nature communications, 8(1), 717-717 (2017-09-30)
During ageing, microglia acquire a phenotype that may negatively affect brain function. Here we show that ageing microglial phenotype is largely imposed by interferon type I (IFN-I) chronically present in aged brain milieu. Overexpression of IFN-β in the CNS of
Hong-Ping Chen et al.
Journal of cellular physiology, 234(12), 23315-23325 (2019-05-30)
MicroRNAs (miRNAs) is a small molecule (19-25 nucleotide) noncoding RNA that inhibits the expression of target messenger RNA (mRNA) at the posttranscriptional level as an endogenous regulator. There is an increasing evidence that miR-199a-3p has a significant effect on the
Jing-Jing Zhang et al.
Molecular cancer, 13, 130-130 (2014-06-03)
Increasing evidence indicates an important role of transcription factor Yin Yang-1 (YY1) in human tumorigenesis. However, its function in cancer remains controversial and the relevance of YY1 to pancreatic ductal adenocarcinoma (PDAC) remains to be clarified. In this study, we
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.