Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU110401

Sigma-Aldrich

MISSION® esiRNA

targeting human IDH1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGAC

N° accesso Ensembl | uomo

ENSG00000138413

N° accesso NCBI

NM_005896

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IDH1(3417) , IDH1(3417)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
FCU
NXT
CXS
QCS
IBS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Daniel R Wahl et al.
Cancer research, 77(4), 960-970 (2016-12-08)
NADPH is a critical reductant needed in cancer cells to fuel the biosynthesis of deoxynucleotides and antioxidants and to sustain stress-survival responses after radiation-induced DNA damage. Thus, one rational strategy to attack cancer cells is to target their heavy reliance
Qi Wang et al.
Oncology reports, 43(1), 188-200 (2019-11-21)
Mutation of the isocitrate dehydrogenase (IDH) gene is regarded a novel indicator for the prognosis of patients with glioma. However, the role of the IDH1 gene mutations in carcinogenesis and the mechanisms underlying their function in glioblastoma multiforme (GBM) remain
Xiayi Liu et al.
Journal of cellular physiology, 234(7), 11602-11609 (2018-11-30)
DDIT3 is of great importance in endoplasmic reticulum stress and is involved in many inflammatory diseases and mineralization processes. The cementum protects teeth from periodontitis and provides attachment for Sharpey's fibers of the periodontal ligament. However, the effect of DDIT3
Chan Chung et al.
Cancer cell, 38(3), 334-349 (2020-08-17)
H3K27M diffuse intrinsic pontine gliomas (DIPGs) are fatal and lack treatments. They mainly harbor H3.3K27M mutations resulting in H3K27me3 reduction. Integrated analysis in H3.3K27M cells, tumors, and in vivo imaging in patients showed enhanced glycolysis, glutaminolysis, and tricarboxylic acid cycle metabolism

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.