Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU108071

Sigma-Aldrich

MISSION® esiRNA

targeting human SCD

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lei Li et al.
PloS one, 8(9), e75104-e75104 (2013-09-27)
Increased de novo lipogenesis is one of the major metabolic events in cancer. In human hepatocellular carcinoma (HCC), de novo lipogenesis has been found to be increased and associated with the activation of AKT/mTOR signaling. In mice, overexpression of an
Mohamed Amine Lounis et al.
Cancers, 12(11) (2020-11-15)
De novo lipogenesis (DNL) is now considered as a hallmark of cancer. The overexpression of key enzymes of DNL is characteristic of both primary and advanced disease and may play an important role in resistance to therapies. Here, we showed
Dawei Yao et al.
Journal of cellular physiology, 232(3), 635-649 (2016-06-25)
Stearoyl-CoA desaturase 1 (SCD1) is a key enzyme for the synthesis of the monounsaturated fatty acids (MUFA) palmitoleic acid and oleic acid. In non-ruminant species, SCD1 expression is known to be tightly regulated by a variety of transcription factors. Although
Yurena Vivas-García et al.
Molecular cell, 77(1), 120-137 (2019-11-18)
Phenotypic and metabolic heterogeneity within tumors is a major barrier to effective cancer therapy. How metabolism is implicated in specific phenotypes and whether lineage-restricted mechanisms control key metabolic vulnerabilities remain poorly understood. In melanoma, downregulation of the lineage addiction oncogene
Vishalakshi Nanjappa et al.
Cancer biology & therapy, 16(11), 1593-1603 (2015-09-24)
Chewing tobacco is a common practice in certain socio-economic sections of southern Asia, particularly in the Indian subcontinent and has been well associated with head and neck squamous cell carcinoma. The molecular mechanisms of chewing tobacco which leads to malignancy

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.