EHU099351
MISSION® esiRNA
targeting human CDK1
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Codice UNSPSC:
41105324
NACRES:
NA.51
Descrizione
Powered by Eupheria Biotech
Nome Commerciale
MISSION®
Stato
lyophilized powder
Sequenza bersaglio del cDNA di esiRNA
CCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGG
N° accesso Ensembl | uomo
N° accesso NCBI
Condizioni di spedizione
ambient
Temperatura di conservazione
−20°C
Categorie correlate
Descrizione generale
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Codice della classe di stoccaggio
10 - Combustible liquids
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Masanori Saito et al.
Scientific reports, 6, 20622-20622 (2016-02-11)
Skeletal development is tightly regulated through the processes of chondrocyte proliferation and differentiation. Although the involvement of transcription and growth factors on the regulation of skeletal development has been extensively studied, the role of cell cycle regulatory proteins in this
To senesce or not to senesce: how primary human fibroblasts decide their cell fate after DNA damage.
Gabriel Kollarovic et al.
Aging, 8(1), 158-177 (2016-02-03)
Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data
Chen Sai et al.
International heart journal, 60(2), 374-383 (2019-02-13)
Atrial fibrillation has caused severe burden for people worldwide. Differentiation of fibroblasts into myofibroblasts, and consequent progress in atrial structural remodeling have been considered the basis for persistent atrial fibrillation, yet little is known about the molecular mechanisms underlying the
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.