Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU097831

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGGACCCAATACTCGGAGACTGACTGTTAGCACATGGCTCCTTCGTCAGGGCCTCATTGACACCAGCCTGACGGCATCTGTGGCCAACTTACTGGCTATTGCAATCGAGAGGCACATTACGGTTTTCCGCATGCAGCTCCACACACGGATGAGCAACCGGCGGGTAGTGGTGGTCATTGTGGTCATCTGGACTATGGCCATCGTTATGGGTGCTATACCCAGTGTGGGCTGGAACTGTATCTGTGATATTGAAAATTGTTCCAACATGGCACCCCTCTACAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Songbai Lin et al.
The American journal of pathology, 188(2), 353-366 (2017-11-13)
Intestinal epithelial cells form a barrier that is critical in protecting the host from the hostile luminal environment. Previously, we showed that lysophosphatidic acid (LPA) receptor 1 regulates proliferation of intestinal epithelial cells, such that the absence of LPA1 mitigates
Hui Ying Li et al.
Kidney international, 91(6), 1362-1373 (2017-01-24)
Lysophosphatidic acid (LPA) is known to regulate various biological responses by binding to LPA receptors. The serum level of LPA is elevated in diabetes, but the involvement of LPA in the development of diabetes and its complications remains unknown. Therefore
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.
Debashish Sahay et al.
Oncotarget, 6(24), 20604-20620 (2015-06-23)
Lysophosphatidic acid (LPA) is a bioactive lipid promoting cancer metastasis. LPA activates a series of six G protein-coupled receptors (LPA1-6). While blockage of LPA1in vivo inhibits breast carcinoma metastasis, down-stream genes mediating LPA-induced metastasis have not been yet identified. Herein

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.