Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU097271

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Wenjie Li et al.
Molecular medicine reports, 14(6), 5334-5342 (2016-10-26)
Simvastatin (SIM), a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, has been reported to inhibit the activity of hepatitis B virus (HBV), however, the mechanism underlying its antiviral function remains unknown. Minichromosome maintenance (MCM) 7, a component of the MCM complex, has been reported to
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Xu Zhang et al.
Oncology reports, 33(5), 2599-2605 (2015-03-05)
Human non-small cell lung carcinoma (NSCLC) is one of the most common cancer worldwide. In previous studies, lovastatin, acting as an inhibitor of 3-hydroxy-3-methylglutaryl Co A (HMG-CoA) reductase, exhibited significant antitumor activity during tumorigenesis. However, whether or not this effect

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.