Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU093811

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR8

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCAGCCATTCCTCATGTCAAATATTTGGATTTGACAAACAATAGACTAGACTTTGATAATGCTAGTGCTCTTACTGAATTGTCCGACTTGGAAGTTCTAGATCTCAGCTATAATTCACACTATTTCAGAATAGCAGGCGTAACACATCATCTAGAATTTATTCAAAATTTCACAAATCTAAAAGTTTTAAACTTGAGCCACAACAACATTTATACTTTAACAGATAAGTATAACCTGGAAAGCAAGTCCCTGGTAGAATTAGTTTTCAGTGGCAATCGCCTTGACATTTTGTGGAATGATGATGACAACAGGTATATCTCCATTTTCAAAGGTCTCAAGAATCTGACACGTCTGGATTTATCCCTTAATAGGCTGAAGCACATCCCAAATGAAGCATTCCTTAATTTGCCAGCGAGTCTCACT

N° accesso Ensembl | uomo

ENSG00000101916

N° accesso NCBI

NM_138636

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TLR8(51311) , TLR8(51311)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

G Comito et al.
Oncogene, 38(19), 3681-3695 (2019-01-22)
Leukocyte infiltration plays an active role in controlling tumor development. In the early stages of carcinogenesis, T cells counteract tumor growth. However, in advanced stages, cancer cells and infiltrating stromal components interfere with the immune control and instruct immune cells
Huanle Luo et al.
Antiviral research, 151, 55-62 (2018-01-15)
Zika virus (ZIKV) is a mosquito-borne flavivirus associated with severe neonatal birth defects, but the causative mechanism is incompletely understood. ZIKV shares sequence homology and early clinical manifestations with yellow fever virus (YFV) and dengue virus (DENV) and are all
Mark A Bernard et al.
PloS one, 9(8), e104039-e104039 (2014-08-05)
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In
Noriko Ishii et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5118-5128 (2014-10-10)
Nucleic acid-sensing TLRs are involved in both antimicrobial immune responses and autoimmune inflammation. TLR8 is phylogenetically and structurally related to TLR7 and TLR9, which undergo proteolytic processing in the endolysosomes to generate functional receptors. Recent structural analyses of human TLR8
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.