Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU093291

Sigma-Aldrich

MISSION® esiRNA

targeting human IRAK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCCTCCAGAAAGTCGAGCAGCACCCACCTCCAACCTCGGGCCAGTGTCTTCAGGCTTTACTGGGGACCTGCGAGCTGGCCTAATGTGGTGGCCTGCAAGCCAGGCCATCCCTGGGCGCCACAGACGAGCTCCGAGCCAGGTCAGGCTTCGGAGGCCACAAGCTCAGCCTCAGGCCCAGGCACTGATTGTGGCAGAGGGGCCACTACCCAAGGTCTAGCTAGGCCCAAGACCTAGTTACCCAGACAGTGAGAAGCCCCTGGAAGGCAGAAAAGTTGGGAGCATGGCAGACAGGGAAGGGAAACATTTTCAGGGAAAAGACATGTATCACATGTCTTCAGAAGCAAGTCAGGTTTCATGTAACCGAGTGTCCTCTTGCGTGTCCAAAAGTAGCCCAGGGCTGTAGCACAGGCTTCACAGTGATT

N° accesso Ensembl | uomo

ENSG00000184216

N° accesso NCBI

NM_001569

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IRAK1(3654) , IRAK1(3654)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ZST
NRR
RPR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xian Shuang Liu et al.
Molecular neurobiology, 54(1), 227-237 (2016-01-08)
Stroke induces new myelinating oligodendrocytes that are involved in ischemic brain repair. Molecular mechanisms that regulate oligodendrogenesis have not been fully investigated. MicroRNAs (miRNAs) are small non-coding RNA molecules that post-transcriptionally regulate gene expression. MiR-146a has been reported to regulate
Yan Gao et al.
Molecular medicine reports, 14(6), 5685-5692 (2016-11-24)
The present study aimed to reduce the expression of interleukin-1 receptor-associated kinase 1 (IRAK-1) in dendritic cells (DCs) by RNA interference (RNAi). Subsequently, its effects on the expression of costimulatory surface molecules, the release of inflammatory cytokines, and the proliferation of
Wei Chen et al.
OncoTargets and therapy, 13, 12787-12796 (2020-12-29)
Interleukin-1 receptor-associated kinase 1 (IRAK1) was shown to contribute to a variety of cancer-related processes. However, the function of IRAK1 in hepatocellular carcinoma (HCC) pathogenesis has not been investigated in detail. IRAK1 expression in HCC was examined by immunohistochemistry, qRT-PCR
Hong-Yi Zhang et al.
Journal of pediatric surgery, 55(11), 2308-2316 (2020-04-24)
To investigate the effects of low dose endotoxin on transcriptional activity in intestinal epithelium, and its role in necrotizing enterocolitis (NEC). Lipopolysaccharides (LPS) were injected into the amniotic cavity of pregnant mice under ultrasound guidance. The effects of LPS on
Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.