Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU093271

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (2)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGCACAGACAGCACTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGAAAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATCATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGC

N° accesso Ensembl | uomo

ENSG00000124333

N° accesso NCBI

NM_005638

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... VAMP7(6845) , VAMP7(6845)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Azioni biochim/fisiol

VAMP7 (vesicle-associated membrane protein 7) is mainly involved with granule trafficking and secretion. It is a platelet VAMP isoform, which is associated with fusion processes during membrane remodeling. It is responsible for neurite outgrowth, lysosome secretion during cell movement, vesicular transport to the apical membrane in epithelial cells, autophagosome biogenesis, release of autophagic vesicles, heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. VAMP7 is also involved with the fusion of trans-Golgi network-derived lysosome-linked membrane protein carriers with late endosomes. Increase in the gene copy number of VAMP7 causes alteration in estrogen receptor action, thereby disrupting male urogenital development.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ZRU
YRU
IPU
DOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Increased gene copy number of VAMP7 disrupts human male urogenital development through altered estrogen action.
Tannour-Louet M
Nature Medicine, 20, 715-715 (2014)
hVps41 and VAMP7 function in direct TGN to late endosome transport of lysosomal membrane proteins.
Pols MS
Nature Communications, 4, 1361-1361 (2013)
Laure-Anne Ligeon et al.
Autophagy, 10(9), 1588-1602 (2014-07-22)
Yersinia pseudotuberculosis can replicate inside macrophages by hijacking autophagy and blocking autophagosome acidification. In bone marrow-derived macrophages, the bacteria are mainly observed inside double-membrane vacuoles positive for LC3, a hallmark of autophagy. Here, we address the question of the membrane
Secil Koseoglu et al.
Blood, 126(5), 651-660 (2015-05-23)
Platelet activation results in profound morphologic changes accompanied by release of granule contents. Recent evidence indicates that fusion of granules with the plasma membrane during activation provides auxiliary membrane to cover growing actin structures. Yet little is known about how
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.