Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU092661

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT8

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCTCTGCAAACTTCCATTCTTTAGATGACATCTACTATTTTGGGGGCCAGAATGCCCACAATCAAATTGCCATTTATGCTCACCAACCCCGAACTGCAGATGAAATTCCCATGGAACCTGGAGATATCATTGGTGTGGCTGGAAATCATTGGGATGGCTATTCTAAAGGTGTCAACAGGAAATTGGGAAGGACGGGCCTATATCCCTCCTACAAAGTTCGAGAGAAGATAGAAACGGTCAAGTACCCCACATATCCTGAGGCTGAGAAATAAAGCTCAGATGGAAGAGATAAACGACCAAACTCAGTTCGACCAAACTCAGTTCAAACCATTTCAGCCAAACTGTAGATGAAGAGGGCTCTGATCTAACAAAATAAGGTTATATGAGTAGATACTCTCAGCACCAAGAGCAGCTGGGAACTGAC

N° accesso Ensembl | uomo

ENSG00000033170

N° accesso NCBI

NM_178154

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FUT8(2530) , FUT8(2530)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ming Yu et al.
Placenta, 75, 45-53 (2019-02-05)
Trophoblast proliferation and invasion are essential for embryo implantation and placentation. Protein glycosylation is one of the most common and vital post-translational modifications, regulates protein physical and biochemical properties. FUT8 is the only known fucosyltransferase responsible for catalyzing α1,6-fucosylation in
Shu Li et al.
Viruses, 11(4) (2019-04-27)
Hepatitis C virus (HCV) is a major cause of human chronic liver disease and hepatocellular carcinoma. Our recent studies showed that α1,6-fucosyltransferase (FUT8), a key glycosyltransferase, was the most up-regulated glycosyltransferase after the HCV infection of human hepatocellular carcinoma Huh7.5.1
Kazuhiro Tada et al.
Surgery today, 50(7), 767-777 (2020-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer. It is an aggressive malignancy associated with poor prognosis because of recurrence, metastasis, and treatment resistance. Aberrant glycosylation of cancer cells triggers their migration and invasion and is
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.