Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU092071

Sigma-Aldrich

MISSION® esiRNA

targeting human FTO

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGAAGATTGGCCTCTTTCCTTTCTCTAAGACAAACCTAAGTAAAAGCCTGAGCTTTGAGTCCTATGCTCAGCACACGGGAAGGAGATGTTAATAATTAAAATAAAGTTGATATCCTGTCTTTAGGGAGTTCCCTTGATCTCTTGAAAGAGACACAGCCCCATTTACATTATTTCGTGGATTTCACCAGCATAGTATAGTTTTTTTCTGTAAGTCCCTCATTCTTATGTAATAACAGGTGGAACTGAGGTTTGAAGAACCTCAGTGGCCCATCCTGATGACATTGGAGACTCAAAGAGACAAGAGAGAGTAGGGTTTAAAACCTGAGCTTTAAGACTCCCACTAGCTTCGTGTCCTTTGGCATGTTAACGTGCCTCAGTTTCCTCATCTGTATAATGGGGATATATGAAAGGCACCAGTCCTAAGG

N° accesso Ensembl | uomo

ENSG00000140718

N° accesso NCBI

NM_001080432

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FTO(79068) , FTO(79068)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Dong Xu et al.
Oncology reports, 38(4), 2285-2292 (2017-08-30)
Fat mass and obesity associated (FTO) is a protein-coding gene. FTO gene is an obesity related gene, also known as the obesity gene. It has been reported previously that FTO is associated with a variety of malignant cancers, such as
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Ziqi Ye et al.
Oncology letters, 20(2), 1409-1417 (2020-07-30)
Liver cancer is the fourth leading cause of cancer-associated mortality worldwide. Statistics indicate that the incidence of liver cancer has been increasing and that its prognosis remains poor. Fat mass and obesity-associated protein (FTO) is a demethylase that is involved
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Bo-Jhih Guan et al.
Molecular cell, 68(5), 885-900 (2017-12-09)
The integrated stress response (ISR) is a homeostatic mechanism induced by endoplasmic reticulum (ER) stress. In acute/transient ER stress, decreased global protein synthesis and increased uORF mRNA translation are followed by normalization of protein synthesis. Here, we report a dramatically

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.