Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU089561

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM12

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACCTCTGGATCCCAGTGAAGAGCTTCGACTCCAAGAATCATCCAGAAGTGCTGAATATTCGACTACAACGGGAAAGCAAAGAACTGATCATAAATCTGGAAAGAAATGAAGGTCTCATTGCCAGCAGTTTCACGGAAACCCACTATCTGCAAGACGGTACTGATGTCTCCCTCGCTCGAAATTACACGGTAATTCTGGGTCACTGTTACTACCATGGACATGTACGGGGATATTCTGATTCAGCAGTCAGTCTCAGCACGTGTTCTGGTCTCAGGGGACTTATTGTGTTTGAAAATGAAAGCTATGTCTTAGAACCAATGAAAAGTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTCCGGGGATCATGTGGATCACATCACAACACACCAAACCTCGCTGCAAAGAATGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lingdan Chen et al.
Experimental biology and medicine (Maywood, N.J.), 242(14), 1432-1443 (2017-06-24)
Individuals with diabetes mellitus suffer from impaired angiogenesis and this contributes to poorer peripheral arterial disease outcomes. In experimental peripheral arterial disease, angiogenesis and perfusion recovery are impaired in mice with diabetes. We recently showed that a disintegrin and metalloproteinase
Junwen Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 1066-1077 (2017-11-16)
Pituitary adenomas are the second most common primary brain tumor with invasive properties. We have previously identified that ADAM12 (a disintegrin and metalloprotease 12) overexpression is associated with the tumor invasion of pituitary adenomas, however, the underlying mechanism remains unknown.
Sara Duhachek-Muggy et al.
Molecular cancer, 16(1), 32-32 (2017-02-06)
ADAM12 is upregulated in human breast cancers and is a predictor of chemoresistance in estrogen receptor-negative tumors. ADAM12 is induced during epithelial-to-mesenchymal transition, a feature associated with claudin-low breast tumors, which are enriched in cancer stem cell (CSC) markers. It
Yuto Nakamura et al.
American journal of physiology. Heart and circulatory physiology, 318(2), H238-H251 (2019-11-28)
A disintegrin and metalloproteinase (ADAM)12 is considered to promote cardiac dysfunction based on the finding that a small-molecule ADAM12 inhibitor, KB-R7785, ameliorated cardiac function in a transverse aortic constriction (TAC) model by inhibiting the proteolytic activation of heparin-binding-EGF signaling. However
Roopali Roy et al.
Molecular cancer research : MCR, 15(11), 1608-1622 (2017-08-03)
ADAM12, (

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.