Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU087231

Sigma-Aldrich

MISSION® esiRNA

targeting human BACE1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACATTGCTGCCATCACTGAATCAGACAAGTTCTTCATCAACGGCTCCAACTGGGAAGGCATCCTGGGGCTGGCCTATGCTGAGATTGCCAGGCCTGACGACTCCCTGGAGCCTTTCTTTGACTCTCTGGTAAAGCAGACCCACGTTCCCAACCTCTTCTCCCTGCAGCTTTGTGGTGCTGGCTTCCCCCTCAACCAGTCTGAAGTGCTGGCCTCTGTCGGAGGGAGCATGATCATTGGAGGTATCGACCACTCGCTGTACACAGGCAGTCTCTGGTATACACCCATCCGGCGGGAGTGGTATTATGAGGTGATCATTGTGCGGGTGGAGATCAATGGACAGGATCTGAAAATGGACTGCAAGGAGTACAACTATGACAAGAGCATTGTGGACAGTGGCACCACCAACCTTCGTTTGCCCAAGAAAGTGTT

N° accesso Ensembl | uomo

ENSG00000186318

N° accesso NCBI

NM_012104

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BACE1(23621) , BACE1(23621)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chi Zhang et al.
Current pharmaceutical biotechnology, 20(1), 56-62 (2019-02-08)
To deliver drugs to treat Alzheimer's Disease (AD), nanoparticles should firstly penetrate through blood brain barrier, and then target neurons. Recently, we developed an Apo A-I and NL4 dual modified nanoparticle (ANNP) to deliver beta-amyloid converting enzyme 1 (BACE1) siRNA.
Nan Zhang et al.
Neuroreport, 31(3), 205-212 (2019-12-27)
Alzheimer's disease is the most common neurodegenerative disease, characterized by accumulation of amyloid β peptides. MicroRNAs have been identified as significant regulators and therapeutic targets of Alzheimer's disease. However, the roles of miR-16-5p and miR-19b-3p and their mechanisms in Alzheimer's
Xiaoyao Zheng et al.
Acta biomaterialia, 49, 388-401 (2016-11-16)
To realize the therapeutic potential of gene drugs for Alzheimer's disease (AD), non-invasive, tissue-specific and efficient delivery technologies must be developed. Here, a hybrid system for amyloid plaques targeted siRNA delivery was formed by PEGylated Poly(2-(N,N-dimethylamino) ethyl methacrylate) (PEG-PDMAEMA) conjugated
Pengzhen Wang et al.
Journal of controlled release : official journal of the Controlled Release Society, 279, 220-233 (2018-04-22)
β-site amyloid precursor protein cleaving enzyme 1 (BACE1) is a key enzyme to cleave the amyloid precursor protein to develop Alzheimer's disease (AD). Reducing BACE1 expression in central neuron through RNA interference technology shows great promise to overcome AD. However
Sujoy Bera et al.
EMBO reports, 21(6), e47954-e47954 (2020-04-24)
Cleavage of amyloid precursor protein (APP) by BACE-1 (β-site APP cleaving enzyme 1) is the rate-limiting step in amyloid-β (Aβ) production and a neuropathological hallmark of Alzheimer's disease (AD). Despite decades of research, mechanisms of amyloidogenic APP processing remain highly

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.