Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU087041

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTTTGTGGCCTCAGAATTGATCATTTTCCCCCCACTCTCCCCACACTAACCTGGGTTCCCTTTCCTTCCATCCCTACCCCCTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAGTCCTCACTCCCAGTCCAAATGTCCTCCAGAAGCCTCTGGCTAGAGGCCAGCCCCACCCAGGAGGGAGGGGGCTATAGCTACAGGAAGCACCCCATGCCAAAGCTAGGGTGGCCCTTGCAGTTCAGCACCACCCTAGTCCCTTCCCCTCCCTGGCTCCCATGACCATACTGAGGGACCAACTGGGCCCAAGACAGATGCCCCAGAGCTGTTTATGGCCTCAGCTGCCTCACTTCCTACAAGAGCAGCCTGTG

N° accesso Ensembl | uomo

ENSG00000171552

N° accesso NCBI

NM_001191

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BCL2L1(598) , BCL2L1(598)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jihong Shi et al.
Laboratory investigation; a journal of technical methods and pathology, 98(11), 1423-1437 (2018-08-10)
Hypertrophic scarring is a serious fibrotic skin disease, and the abnormal activation of hypertrophic scar fibroblasts (HSFs) intensifies its pathogenesis. Our previous studies have demonstrated that the dysregulation of autophagy in HSFs is associated with fibrosis. However, knowledge regarding the
Yun Jung Choi et al.
Scientific reports, 9(1), 7193-7193 (2019-05-12)
Mantle cell lymphoma (MCL) is typically an aggressive and rare form of non-Hodgkin lymphoma (NHL) with a poor prognosis despite recent advances in immunochemotherapy and targeted therapeutics against NHL. New therapeutic agents are needed for MCL. In this study, we
Sahar Taghavi et al.
International journal of pharmaceutics, 516(1-2), 301-312 (2016-11-15)
In this project, synergistic cancer cell death was achieved by a targeted delivery system comprising Bcl-xL-specific shRNA and a very low DOX content, which simultaneously activated an intrinsic apoptotic pathway. A modified branched polyethylenimine (PEI 10kDa) was grafted through polyethylene
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Wenshu Chen et al.
Molecular carcinogenesis, 55(11), 1858-1866 (2015-11-27)
The interaction between epithelial and stromal cells through soluble factors such as cytokines plays an important role in carcinogenesis. Breaking this cancer-promoting interaction poses an opportunity for cancer prevention. The tumor-promoting function of interleukin 6 (IL-6) has been documented; however
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.