Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU086801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF10

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGGGAACACCTGATTTTCATACAATCCCAGCATTTTGTTTGACTCCACCTTACAGTCCTTCTGACTTTGAACCCTCTCAAGTGTCAAATCTGATGGCACCAGCGCCATCTACTGTACACTTCAAGTCACTCTCAGATACTGCCAAACCTCACATTGCCGCACCTTTCAAAGAGGAAGAAAAGAGCCCAGTATCTGCCCCCAAACTCCCCAAAGCTCAGGCAACAAGTGTGATTCGTCATACAGCTGATGCCCAGCTATGTAACCACCAGACCTGCCCAATGAAAGCAGCCAGCATCCTCAACTATCAGAACAATTCTTTTAGAAGAAGAACCCACCTAAATGTTGAGGCTGCAAGAAAGAACATACCATGTGCCGCTGTGTCACCAAACAGATCCAAATGTGAGAGAAACACAGTGGCAGATGTTGATGAGA

N° accesso Ensembl | uomo

ENSG00000155090

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KLF10(7071) , KLF10(7071)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Abigail A Delaney et al.
Biology of reproduction, 95(3), 62-62 (2016-08-05)
Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human
Vivek Kumar Mishra et al.
Cancer research, 77(9), 2387-2400 (2017-03-03)
TGFβ-SMAD signaling exerts a contextual effect that suppresses malignant growth early in epithelial tumorigenesis but promotes metastasis at later stages. Longstanding challenges in resolving this functional dichotomy may uncover new strategies to treat advanced carcinomas. The Krüppel-like transcription factor, KLF10
Malayannan Subramaniam et al.
Journal of cellular physiology, 233(4), 3540-3551 (2017-10-19)
TIEG knockout (KO) mice exhibit a female-specific osteopenic phenotype and altered expression of TIEG in humans is associated with osteoporosis. Gene expression profiling studies identified sclerostin as one of the most highly up-regulated transcripts in the long bones of TIEG
Jong Min Lee et al.
Molecular therapy. Nucleic acids, 17, 310-322 (2019-07-10)
We investigated the functional role of miR-892b as a novel inhibitor of chondrocyte hypertrophy during TGF-β-mediated chondrogenesis of human mesenchymal stem cells (hMSCs). The expression of miR-892b during TGF-β-mediated chondrogenesis of hMSCs and the effects of miR-892b overexpression on chondrogenic
Chun-Liang Lin et al.
EMBO molecular medicine, 11(5) (2019-04-06)
Diabetic nephropathy is the leading cause of end-stage renal disease. Although dysfunction of podocytes, also termed glomerular visceral epithelial cells, is critically associated with diabetic nephropathy, the mechanism underlying podocyte dysfunction still remains obscure. Here, we identify that KDM6A, a

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.