Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU083211

Sigma-Aldrich

MISSION® esiRNA

targeting human TLE1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCTCGTCAGTGCTTAGCTGTGACATCTCTGTGGATGATAAGTACATAGTCACTGGCTCGGGGGACAAGAAGGCTACAGTCTATGAAGTCATCTACTGAAAACATTATGTGGTTTAACGTTTATAGTTGAATTGGGCCAAAATGTTTCGAATTTATAGAAATAGAAAAGTTGTAACTTTAAAAGAGAAAAAAAATTACAAACACCTGTTTCCAAACCTTGACAGAAAACTACTTTGAGTCTACAAAGAGGAGGCGACAAGTCCATCAGCAGAAAGTCACCTGTCTACATAGACCAAATGGAGCACCAAGGCCAAGCGGACAGAGGGGCCATGGGTTGTAGGATTGAGGAACGGAATCTGCCGACTCACATGACAGCCCATTCTTTCTTTCTGGGTGATCTGGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wei Chen et al.
Bioscience, biotechnology, and biochemistry, 84(6), 1176-1182 (2020-03-03)
Liver damage induced by ischemia/reperfusion (I/R) remains a primary issue in multiple hepatic surgeries. Innate immune-mediated inflammatory responses during the reperfusion stage aggravate the injury. Nevertheless, the detailed mechanism of hepatic I/R has not been fully clarified yet. Our research
Federica De Paoli et al.
FEBS letters, 590(1), 43-52 (2016-01-15)
Macrophages display heterogeneous phenotypes, including the classical M1 proinflammatory and the alternative M2 anti-inflammatory polarization states. The transducin-like enhancer of split-1 (TLE1) is a transcriptional corepressor whose functions in macrophages have not been studied yet. We report that TLE1 is
Xin Yao et al.
Oncotarget, 8(42), 72235-72249 (2017-10-27)
The Transducin-like enhancer of split 1 (TLE1) corepressor protein is overexpressed in human lung tumors and is a putative lung-specific oncogene. However, the molecular mechanism underlying its oncogenic function remains to be delineated. Here, we report an important role of
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.