Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU081851

Sigma-Aldrich

MISSION® esiRNA

targeting human ANGPT2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mi-Lan Kang et al.
Journal of cellular biochemistry, 118(9), 2896-2908 (2017-02-19)
Our previous studies revealed that co-transplantation of bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) can enhance bone regeneration and angiogenesis. However, it is unclear which genes are involved in the regulation of osteogenesis and/or angiogenesis during the
Jing Xu et al.
American journal of physiology. Cell physiology, 313(3), C262-C273 (2017-06-24)
Angiopoietin-2 (Ang-2) contributes to vascular hyporeactivity after hemorrhagic shock and hypoxia through upregulation of inducible nitric oxide synthase (iNOS) in a vascular endothelial cell (VEC)-specific and Ang-2/Tie2 receptor-dependent manner. While iNOS is primarily expressed in vascular smooth muscle cells (VSMCs)
Don Yuen et al.
Investigative ophthalmology & visual science, 55(5), 3320-3327 (2014-05-02)
Lymphatic research has progressed rapidly in recent years. Lymphatic dysfunction has been found in myriad disorders from cancer metastasis to transplant rejection; however, effective treatment for lymphatic disorders is still limited. This study investigates the role of angiopoietin-2 (Ang-2) in
Changqing Luo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 34(3), 916-928 (2014-09-10)
To investigate the role of angiopoietin-2 (Ang-2) and IL-18 in the pathogenesis of diabetic nephropathy (DN) and the molecular mechanisms through which alprostadil protects renal function. DN was induced by streptozotocin and intraperitoneal injection of alprostadil was given to diabetic

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.