Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU080971

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCTATGGAGCAAGTTCTGCAGATGGTTCCAGAGACGGGAGTCCTGGGCCCAGAGCCGAGATGAGCAGAACCTGCTGCAGCAGAAGAGGATCTGGGAGTCTCCTCTCCTTCTAGCTGCCAAAGATAATGATGTCCAGGCCCTGAACAAGTTGCTCAAGTATGAGGATTGCAAGGTGCACCAGAGAGGAGCCATGGGGGAAACAGCGCTACACATAGCAGCCCTCTATGACAACCTGGAGGCCGCCATGGTGCTGATGGAGGCTGCCCCGGAGCTGGTCTTTGAGCCCATGACATCTGAGCTCTATGAGGGTCAGACTGCACTGCACATCGCTGTTGTGAACCAGAACATGAACCTGGTGCGAGCCCTGCTTGCCCGCAGGGCCAGTGTCTCTGCCAGAGCCACAGGCACTGCCTTCCGCCGTAGTCCCTGCAACCTCAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

M Skrzypski et al.
Biochimica et biophysica acta, 1853(12), 3202-3210 (2015-09-20)
Transient receptor potential channel vanilloid type 6 (TRPV6) is a non-selective cation channel with high permeability for Ca²⁺ ions. So far, the role of TRPV6 in pancreatic beta cells is unknown. In the present study, we characterized the role of
Cuiping Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(4), 1695-1709 (2018-12-07)
Parathyroid hormone-related protein (PTHrP) is implicated in regulating calcium homeostasis in vertebrates, including sea bream, chick, and mammals. However, the molecular mechanism underlying the function of PTHrP in regulating calcium transport is still not fully investigated. This study aimed to
Shigenori Miura et al.
Nature communications, 6, 8871-8871 (2015-11-14)
Microvilli are cellular membrane protrusions present on differentiated epithelial cells, which can sense and interact with the surrounding fluid environment. Biochemical and genetic approaches have identified a set of factors involved in microvilli formation; however, the underlying extrinsic regulatory mechanism
H Bond et al.
The Journal of physiology, 586(7), 2015-2025 (2008-02-09)
The role of parathyroid hormone-related protein (PTHrP) in fetal calcium homeostasis and placental calcium transport was examined in mice homozygous for the deletion of the PTHrP gene (PTHrP-/- null; NL) compared to PTHrP+/+ (wild-type; WT) and PTHrP+/- (heterozygous; HZ) littermates.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.