Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU074901

Sigma-Aldrich

MISSION® esiRNA

targeting human CBLB

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCTCTCCAAAACCTGGAATCACAGCGAGTTCAAATGTCAATGGAAGGCACAGTAGAGTGGGCTCTGACCCAGTGCTTATGCGGAAACACAGACGCCATGATTTGCCTTTAGAAGGAGCTAAGGTCTTTTCCAATGGTCACCTTGGAAGTGAAGAATATGATGTTCCTCCCCGGCTTTCTCCTCCTCCTCCAGTTACCACCCTCCTCCCTAGCATAAAGTGTACTGGTCCGTTAGCAAATTCTCTTTCAGAGAAAACAAGAGACCCAGTAGAGGAAGATGATGATGAATACAAGATTCCTTCATCCCACCCTGTTTCCCTGAATTCACAACCATCTCATTGTCATAATGTAAAACCTCCTGTTCGGTCTTGTGATAATGGTCACTGTATGCTGAATGGAACACATGGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wei-Xia Yang et al.
FEBS letters, 589(15), 1975-1980 (2015-06-27)
Orosomucoid 1-Like Protein 3 (ORMDL3) is an asthma candidate gene and Casitas B lineage lymphoma b (Cbl-b), an E3 ubiquitin ligase, is a critical factor in maintaining airway immune tolerance. However, the association of Cbl-b with ORMDL3 for asthma is
Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
Yubo Cao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5607-5615 (2015-02-24)
Mammalian target of rapamycin (mTOR) has emerged as a new potential therapeutic target for gastric cancer. However, a phase III clinical trial found that monotherapy with the mTOR inhibitor everolimus did not significantly improve the overall survival of patients with

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.