Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU073541

Sigma-Aldrich

MISSION® esiRNA

targeting human MGEA5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACTGCACCTTGTGAATGGTAGTTGAGGTCTTCATACAGTTCAGCCTCTAGAATGGTAACAAATCAGCCAATTGGATTCGAAACAAAGAAGACTATGTAAAACTCACCCATCACACTTTGAGACTACTCACTGGTTGGAAGAATATAGTATTGCAGCAAATCCTGTATGAAAGAGAGATGTGGGCTTCCTTTTTGAGTCTTGTGTTAGGTGCTGAGACCTTTTACATGGGCTTATACAGGGAGAGAGTCTTCAATAAATGTAGTCAGCACTATTTTCTGCATCCAGTGTGGTTGCGTTTCTCACCTGAGAGTAATCAAGATAACATCTGTCATCTTCCTTGGTTTATTGAGTGAAATGCCTCTCAGTCTTAGGGGACATGGCAGAGATGAAAGAAAGAAAGAGTGGGTTTCAGAAGTGTCAGGGTGGAGTGATTCCAAGTGGGATGGTT

N° accesso Ensembl | uomo

ENSG00000198408

N° accesso NCBI

NM_012215

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MGEA5(10724) , MGEA5(10724)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ABV
CZU
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Miguel C Lucena et al.
The Journal of biological chemistry, 291(25), 12917-12929 (2016-04-30)
Deregulated cellular metabolism is a hallmark of tumors. Cancer cells increase glucose and glutamine flux to provide energy needs and macromolecular synthesis demands. Several studies have been focused on the importance of glycolysis and pentose phosphate pathway. However, a neglected
Md Ataur Rahman et al.
Oxidative medicine and cellular longevity, 2019, 6279313-6279313 (2019-12-13)
The addition of O-linked β-N-acetylglucosamine (O-GlcNAcylation) to serine and threonine residues is a common posttranslational modification of intracellular proteins which modulates protein functions and neurodegenerative diseases, controlled by a single pair of enzymes, O-GlcNAcase (OGA), and O-GlcNAcylation transferase (OGT). Autophagy
Maïté Leturcq et al.
Cellular and molecular life sciences : CMLS, 75(23), 4321-4339 (2018-08-03)
O-GlcNAcylation of proteins is governed by O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA). The homeostasis of O-GlcNAc cycling is regulated during cell cycle progression and is essential for proper cellular division. We previously reported the O-GlcNAcylation of the minichromosome maintenance proteins
Anupriya Chatterjee et al.
Cells, 9(10) (2020-10-23)
Our previous studies identified that retinal endothelial damage caused by hyperglycemia or nucleoside diphosphate kinase-B (NDPK-B) deficiency is linked to elevation of angiopoietin-2 (Ang-2) and the activation of the hexosamine biosynthesis pathway (HBP). Herein, we investigated how NDPK-B is involved

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.