Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU070821

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AATGAAGTTGCGGAAATGTTAAGAGATTTAAATCTTGGTGAAATGAAAAGTGGAGTACCAGTGTTGGCAGTATCCTTAGCATTGGAGGGGAAGGCTAGTCATAGAGAGATGACATCTAAGCTTCTTTCTGACCTTTGTGGGACAGTAATGAGCACAACTGATGTGGAAAAATCATTTGATAAATTGTTGAAAGATCTACCTGAATTAGCACTGGATACTCCTAGAGCACCACAGTTGGTGGGCCAGTTTATTGCTAGAGCTGTTGGAGATGGAATTTTATGTAATACCTATATTGATAGTTACAAAGGAACTGTAGATTGTGTGCAGGCTAGAGCTGCTCTGGATAAGGCTACCGTGCTTCTGAGTATGTCTAAAGGTGGAAAGCGTAAAGATAGTGTGTGGGGCTCTGG

N° accesso Ensembl | uomo

ENSG00000150593

N° accesso NCBI

NM_014456

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PDCD4(27250) , PDCD4(27250)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kun Wang et al.
Molecular medicine reports, 16(5), 6757-6763 (2017-09-14)
Contrast medium (CM) is widely used in cardiac catheterization; however, it may induce acute kidney injury or renal failure, although the underlying mechanism remains to be elucidated. MicroRNA‑21 (miR‑21) is involved in renal disease and has been indicated to regulate
Hongwei Liang et al.
Scientific reports, 6, 23772-23772 (2016-03-30)
Programmed cell death 4 (PDCD4), as a tumor suppressor gene, is frequently reduced in a variety of tumors, including gastric cancer. Previous findings have indicated that PDCD4 participates in tumorigenesis through the regulation of apoptosis, but the molecular basis of
Xiaodong Chen et al.
Anatomical record (Hoboken, N.J. : 2007), 302(8), 1399-1408 (2018-10-20)
Osteosarcoma (OS) is one of the most common malignancies of bone. This study was aimed to explore the anti-metastatic effect of euxanthone on OS. Adhesion assay and Transwell assay were used to examine the effect of euxanthone on adhesion, migration
Ken Watanabe et al.
PloS one, 15(2), e0226053-e0226053 (2020-02-11)
Hypertension is a major public health problem among the aging population worldwide. It causes cardiac remodeling, including hypertrophy and interstitial fibrosis, which leads to development of hypertensive heart disease (HHD). Although microRNA-21 (miR-21) is associated with fibrogenesis in multiple organs
Xiafei Fu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 670-682 (2018-07-20)
Several miRNAs have been reported to be involved in the pathogenesis of polycystic ovarian syndrome (PCOS). However, the biological roles of miR-16 and its molecular mechanisms in PCOS development remain to be elucidated. qRT-PCR was performed to detect the expression
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.