Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU068681

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2B

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGGGAGGTCTATGAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAGAAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAACCTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATCATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCCCTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTGGAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCTGAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACA

N° accesso Ensembl | uomo

ENSG00000120899

N° accesso NCBI

NM_004103

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PTK2B(2185) , PTK2B(2185)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jialin Qian et al.
Oncology letters, 11(3), 1738-1744 (2016-03-22)
Lung cancer, specifically non-small cell lung cancer (NSCLC), is the leading cause of cancer-associated mortality in the world. In previous years, almost no significant advancements have been made towards the molecular characterization of NSCLC, which highlights the requirement for novel
Chien-Chung Yang et al.
International journal of molecular sciences, 21(1) (2020-01-08)
Neuroinflammation is a landmark of neuroinflammatory and neurodegenerative diseases. Matrix metalloproteinase (MMP)-9, one member of MMPs, has been shown to contribute to the pathology of these brain diseases. Several experimental models have demonstrated that lipopolysaccharide (LPS) exerts a pathological role
Shaymaa Ik Al-Juboori et al.
Journal of experimental & clinical cancer research : CR, 38(1), 210-210 (2019-05-24)
Metformin, a biguanide, is one of the most commonly prescribed treatments for type 2 diabetes and has recently been recommended as a potential drug candidate for advanced cancer therapy. Although Metformin has antiproliferative and proapoptotic effects on breast cancer, the
Chih-Chung Lin et al.
Frontiers in molecular neuroscience, 10, 387-387 (2017-12-07)
Neurodegenerative disorders and brain damage are initiated by excessive production of reactive oxygen species (ROS), which leads to tissue injury, cellular death and inflammation. In cellular anti-oxidant systems, heme oxygenase-1 (HO-1) is an oxidative-sensor protein induced by ROS generation or
Qiaoqiao Wan et al.
Scientific reports, 7(1), 9033-9033 (2017-08-24)
Focal adhesion kinase (FAK) and Src family kinases (SFK) are known to play critical roles in mechanotransduction and other crucial cell functions. Recent reports indicate that they reside in different microdomains of the plasma membrane. However, little is known about
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.