Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU067301

Sigma-Aldrich

MISSION® esiRNA

targeting human TFCP2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACAACCACACCTCAGGAAGCTCAGCAGTGGTTGCATCGAAATCGTTTTTCTACATTCACAAGGCTTTTCACAAACTTCTCAGGGGCAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATGGAATCAGACTTTTTAATGCATTAAAAGGCCGGATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTGAGGGAGCAGCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTTCTTCGTTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTCAGCTTTTCAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shi Wang et al.
Acta biochimica et biophysica Sinica, 48(12), 1085-1093 (2016-11-01)
Pancreatic cancer is an aggressive malignancy. The median survival rate remains low, indicating that the identification of novel biomarkers and therapeutic targets is critical. Here, we examined the role of microRNA-182 (miR-182) in pancreatic cancer development. Analysis of human pancreatic
Kedarlal Sharma et al.
Journal of molecular neuroscience : MN, 65(3), 343-350 (2018-07-12)
MeCP2 (methyl-CpG binding protein 2), an epigenetic regulator, has been shown to regulate the function of neurons and glial cells. Our previous study has demonstrated that MeCP2 repress the myelin gene expression in rat oligodendrocytes but whether MeCP2 bind to
Arpita Dave et al.
Journal of molecular neuroscience : MN, 67(1), 16-27 (2018-12-07)
Astrocytes play the central role in CNS metabolism to support neuronal functions. Mehyl-CpG-binding protein 2 (MeCP2) is the global transcription factor with differential expression in neuronal and non-neuronal cells. MeCP2 mutation and downstream detrimental effects have been reported in astrocytes
Jiawei Zhou et al.
Cell death & disease, 8(2), e2597-e2597 (2017-02-10)
Mammalian folliculogenesis is a complex process in which primordial follicles develop into pre-ovulatory follicles, followed by ovulation to release mature oocytes. In this study, we explored the role of miR-144 in ovulation. miR-144 was one of the differentially expressed microRNAs
Buch Lipi et al.
Experimental brain research, 236(11), 3015-3027 (2018-08-18)
Astrocytes perform several critical functions such as promoting neuronal maturation, neuronal survival, maintaining and supporting neurons and oligodendrocytes. Astrocytes participate in the formation of nodes of Ranvier. Recently, studies emphasizing on the role of astrocytes in regulating myelination by secreting

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.