Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU064011

Sigma-Aldrich

MISSION® esiRNA

targeting human PSAT1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCTGACTTGAACTGGAAGCATTTTAAGAAATCTTGTTGCTTTTCTAACAAATTCCCGCGTATTTTGCCTTTGCTGCTACTTTTTCTAGTTAGATTTCAAACTTGCCTGTGGACTTAATAATGCAAGTTGCGATTAATTATTTCTGGAGTCATGGGAACACACAGCACAGAGGGTAGGGGGGCCCTCTAGGTGCTGAATCTACACATCTGTGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCGAAGGGCAAACTGTAGATCGATCTTTATGCTGTTATTACAGGAGAAGTGACATACTTTATATATGTTTATATTAGCAAGGTCTGTTTTTAATACCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yiqun Zhang et al.
OncoTargets and therapy, 13, 5443-5453 (2020-07-02)
A growing number of studies have found that the serine-glycine biosynthesis pathway is highly activated for biosynthesis in cancer progression and metastasis. Phosphoserine aminotransferase 1 (PSAT1) catalyzes the second step of the serine-glycine biosynthesis pathway; the effects and mechanism of
Nadia Vié et al.
Molecular cancer, 7, 14-14 (2008-01-29)
Colorectal cancer (CRC) is one of the most common causes of cancer death throughout the world. In this work our aim was to study the role of the phosphoserine aminotransferase PSAT1 in colorectal cancer development. We first observed that PSAT1
Stephanie Metcalf et al.
Clinical & experimental metastasis, 37(1), 187-197 (2019-10-21)
Breast cancer is the second leading cause of cancer-related deaths among women and 90% of these mortalities can be attributed to progression to metastatic disease. In particular, triple negative breast cancer (TNBC) is extremely aggressive and frequently metastasizes to multiple
J Patrick Murphy et al.
Cell reports, 24(9), 2381-2391 (2018-08-30)
NAD+ is a key metabolic redox cofactor that is regenerated from nicotinamide through the NAD+ salvage pathway. Here, we find that inhibiting the NAD+ salvage pathway depletes serine biosynthesis from glucose by impeding the NAD+-dependent protein, 3-phosphoglycerate dehydrogenase (PHGDH). Importantly, we

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.