Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU054851

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCATGGAAATTCTGGACACCCGCTGGTCCTCAGCTACATCGACCTGTCAGCCTGGTGTTACTACTGTCAGGCCTATGTCCACCACCAGGCTCTCCTAGATGTGAAGAACATCGCCCACCAGAACAAGTTTGGGGAGGATATGCCCCACCCACACTAAGCCCCAGAATACGGTCCCTCTTCACCTTCTGAGGCCCACGATAGACCAGCTGTAGCTCATTCCAGCCTGTACCTTGGATGAGGGGTAGCCTCCCACTGCATCCCATCCTGAATATCCTTTGCAACTCCCCAAGAGTGCTTATTTAAGTGTTAATACTTTTAAGAGAACTGCGACGATTAATTGTGGATCTCCCCCTGCCCATTGCCTGCTTGAGGGGCACCACTACTCCAGCCCAGAAGGAAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mo Cheng et al.
European journal of pharmacology, 840, 1-8 (2018-10-03)
Emerging evidence shows that cytokines such as interleukins (ILs) are involved in the progression and chemoresistance of multiple tumors, including osteosarcoma (OS). Our present study established the doxorubicin (Dox) resistant human OS MG-63 and HOS cells and named them MG-63/Dox
Lei Yang et al.
Journal of molecular and cellular cardiology, 127, 143-153 (2018-12-26)
Extracellular pH strongly affects cellular metabolism and function. An acidic environment induced under pathological conditions leads to cardiomyocyte injury and dysfunction, but the underlying mechanisms are still poorly understood. Autophagy has been reported as a cytoprotective mechanism that maintains cellular
Shigeki Saito et al.
PloS one, 12(10), e0186615-e0186615 (2017-10-19)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and fatal disease. Histone deacetylase 6 (HDAC6) alters function and fate of various proteins via deacetylation of lysine residues, and is implicated in TGF-β1-induced EMT (epithelial-mesenchymal transition). However, the role of HDAC6
Liuqing Xu et al.
Oncotarget, 8(51), 88730-88750 (2017-11-29)
The role of histone deacetylase 6 (HDAC6) in peritoneal fibrosis remains unknown. In this study, we examined the effect of HDAC6 inhibition on the epithelial-mesenchymal transition (EMT) of peritoneal mesothelial cells and development of peritoneal fibrosis. Treatment with tubastatin A
Hui-Wen Chiu et al.
Cancers, 11(11) (2019-11-07)
Radiation therapy (RT) is one of the main treatments for triple-negative breast cancer (TNBC). However, many patients experience RT failure due to the metastatic potential of RT and the radiation resistance of several cancers. Histone deacetylase inhibitors (HDACis) can serve

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.