Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU050131

Sigma-Aldrich

MISSION® esiRNA

targeting human RAF1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCAGAGTGCTGTGCAGTGTTCAGACTTCTCCACGAACACAAAGGTAAAAAAGCACGCTTAGATTGGAATACTGATGCTGCGTCTTTGATTGGAGAAGAACTTCAAGTAGATTTCCTGGATCATGTTCCCCTCACAACACACAACTTTGCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTCAATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTACCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTTATTGTTTCCAAATTCCACTATTGGTGATAGTGGAGTCCCAGCACTACCTTCTTTGACTATGCGTCGTATGCGAGAGTCTGTTTCCAGGATGCCTGTT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jing Lin et al.
Cell cycle (Georgetown, Tex.), 19(19), 2496-2508 (2020-09-16)
Since the essential involvement of microRNAs (miRNAs) in the development and progression of GC, the study was for the exploration of the value of microRNA-7 (miR-7) in the evaluation of neoadjuvant chemotherapy for gastric cancer (GC) and its effects on
Xiaoyu Zhang et al.
ACS central science, 4(1), 71-80 (2018-02-03)
The KRAS gene encodes two isoforms, KRas4a and KRas4b. Differences in the signaling functions of the two KRas proteins are poorly understood. Here we report the comparative and nucleotide-dependent interactomes of KRas4a and KRas4b. Many previously unknown interacting proteins were
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and
Ines Jeric et al.
Nature communications, 7, 13781-13781 (2016-12-22)
Hepatocellular carcinoma (HCC) is a leading cause of cancer deaths, but its molecular heterogeneity hampers the design of targeted therapies. Currently, the only therapeutic option for advanced HCC is Sorafenib, an inhibitor whose targets include RAF. Unexpectedly, RAF1 expression is

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.