Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU046621

Sigma-Aldrich

MISSION® esiRNA

targeting human IL6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGG

N° accesso Ensembl | uomo

ENSG00000136244

N° accesso NCBI

NM_000600

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IL6(3569) , IL6(3569)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Eun-Ah Ye et al.
Vision research, 139, 15-22 (2017-04-24)
microRNA (miRNA) play critical roles in the pathological processes of diabetic retinopathy, including inflammatory responses, insulin signaling, and angiogenesis. In addition to their regulatory functions on gene expression, miRNA is considered as a potential therapeutic target, as well as a
Yaqi Yin et al.
Cell death & disease, 9(7), 760-760 (2018-07-11)
Progressive pancreatic β-cell dysfunction is recognized as a fundamental pathology of type 2 diabetes (T2D). Recently, mesenchymal stem cells (MSCs) have been identified in protection of islets function in T2D individuals. However, the underlying mechanisms remain elusive. It is widely
Shui-Fang Chen et al.
Molecular medicine reports, 16(3), 2733-2739 (2017-06-29)
Resistance to epidermal growth factor receptor (EGFR) inhibitors is of primary concern in the treatment of non‑small‑cell lung cancer (NSCLC) with EGFR mutations. To investigate the effects of matrine on H1975 cells and to examine a novel, potential treatment option for NSCLC
Hu Liu et al.
Biochemical and biophysical research communications, 486(2), 239-244 (2017-03-04)
Limited efficacy of immune checkpoint inhibitors in hepatocellular carcinoma (HCC) was observed in clinical trials, thus prompting investigation into combination therapy. Interleukin-6 (IL-6) has important roles in modeling immune responses in cancers. Here, we hypothesized that IL-6 blockade would enhance
Qiang Fu et al.
Cancer cell international, 17, 79-79 (2017-09-08)
Cisplatin has been used in the treatment of many cancers, including laryngeal cancer; however, its efficacy can be reduced due to the development of drug resistance. This study aimed to investigate whether interleukin-6 (IL-6) knockdown may enhance the efficacy of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.