Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU046081

Sigma-Aldrich

MISSION® esiRNA

targeting human FAT1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AATTGCTGACAACGCCTCTCCGAAGTTTACATCAAAAGAATATTCTGTTGAACTTAGTGAAACTGTCAGCATTGGGAGTTTCGTTGGGATGGTTACAGCCCATAGTCAATCATCAGTGGTGTATGAAATAAAAGATGGAAATACAGGTGATGCTTTTGATATTAATCCACATTCTGGAACTATCATCACTCAGAAAGCCCTGGACTTTGAAACTTTGCCCATTTACACATTGATAATACAAGGAACTAACATGGCTGGTTTGTCCACTAATACAACGGTTCTAGTTCACTTGCAGGATGAGAATGACAACGCGCCAGTTTTTATGCAGGCAGAATATACAGGACTCATTAGTGAATCAGCCTCAATTAACAGCGTGGTCCTAACAGACAGGAATGTCCCACTGG

N° accesso Ensembl | uomo

ENSG00000083857

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FAT1(2195) , FAT1(2195)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xinhui Wu et al.
Cell biology international, 41(1), 24-32 (2016-10-21)
Porcine cumulus cells are localized around oocytes and act as a specific type of granulosa that plays essential roles in the development and maturation of oocytes, the development and atresia of follicles, and the development of embryos. Studies of FAT1
Evanka Madan et al.
International journal of cancer, 139(11), 2570-2582 (2016-08-19)
The hypoxic microenvironment is an important contributor of glioblastoma (GBM) aggressiveness via HIF1α, while tumour inflammation is profoundly influenced by FAT Atypical Cadherin (FAT1). This study was designed to explore the functional interaction and significance of FAT1 and HIF1α under
Andrey Sheyko et al.
Nature, 539(7630), 551-554 (2016-11-08)
A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a
Tung-Nien Hsu et al.
Cancers, 11(12) (2019-12-01)
FAT atypical cadherin 1 (FAT1) regulates cell-cell adhesion and extracellular matrix architecture, while acting as tumor suppressor or oncogene, context-dependently. Despite implication of FAT1 in several malignancies, its role in oral squamous cell carcinoma (OSCC) remains unclear. Herein, we document
Longyue L Cao et al.
Nature, 539(7630), 575-578 (2016-11-10)
Mitochondrial products such as ATP, reactive oxygen species, and aspartate are key regulators of cellular metabolism and growth. Abnormal mitochondrial function compromises integrated growth-related processes such as development and tissue repair, as well as homeostatic mechanisms that counteract ageing and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.