Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU045261

Sigma-Aldrich

MISSION® esiRNA

targeting human SPRY2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTC

N° accesso Ensembl | uomo

ENSG00000136158

N° accesso NCBI

NM_005842

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SPRY2(10253) , SPRY2(10253)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
XQR
DOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jun-Ho Ahn et al.
Biomolecules & therapeutics, 23(4), 320-326 (2015-07-15)
The clinical benefits of oncogenic BRAF inhibitor therapies are limited by the emergence of drug resistance. In this study, we investigated the role of a negative regulator of the MAPK pathway, Spry2, in acquired resistance using BRAF inhibitor-resistant derivatives of
Yan Liu et al.
Molecular medicine reports, 23(5) (2021-03-25)
Age-related cataract (ARC) is the primary cause of blindness worldwide. Abnormal expression of microRNAs (miRNAs/miRs) has been reported to be associated with multiple diseases, including ARC. However, the potential role of miR-124 in ARC remains unclear. The present study used
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.